Hanslune Posted October 15, 2020 #76 Share Posted October 15, 2020 29 minutes ago, cladking said: Why don't you try this as a thought experiment. Say your an ignorant caveman with no scientific knowledge and little more than the ability to make fire and simple tools which are passed down father to son through demonstration. Remember you have no idea why flint breaks the way it does or what the nature of fire is. You have no science and no scientific language or knowledge. You believe your fate is controlled by unseen gods and you exist in a culture that forages and gathers food from myriad sources. You can never be too far away from water and shelter so you must carry tools wand weapons with you. OK, now start inventing a city. Tell me how you're going to settle down and farm. Modern ideas simply don't work. They don't explain how things work or how they evolved. He isn't 'ignorant' Cladking he is a master of survival and while he doesn't understand the science behind why nature does what it does he knows which plants he can eat, he knows which rocks make the best stone tools, he knows the behavior of the animal life, he can make snares and traps and can run down any prey in his area. He knows when certain plants will flower, where water is, when x herd will come to water and where to find shelter from rainfall and how to build a fire. You appear to be trying to start a philosophical discussion the answer to which is your 'ancient science' which will be a hijack of this thread for your ideas. I would suggest that if you want to start a thread on 'How to start a civilization' you go do so and don't try to do it in this guys thread. 3 1 Link to comment Share on other sites More sharing options...
Hanslune Posted October 15, 2020 #77 Share Posted October 15, 2020 5 hours ago, janesix said: Some. There isn't much out there yet. Just conflicting theories. Not much out there? https://www.dainst.blog/the-tepe-telegrams/publications/ Several hundred research papers on that site have been published. 2 1 Link to comment Share on other sites More sharing options...
+Razman Posted October 16, 2020 #78 Share Posted October 16, 2020 Well look at how much 3,000 or 5,000 years can do to erode past structures , imagine what 50,000 can do? Ancient Egypt was quite advanced to build those structures with the accuacy they did.Only thing i question is they buried their dead with worldly items as though they would need them in the afterlife , when we look at that today as , " Well those probably , most likely , almost positively , will not do us any good in the afterlife" , as far as we know. Link to comment Share on other sites More sharing options...
the13bats Posted October 16, 2020 #79 Share Posted October 16, 2020 6 hours ago, papageorge1 said: I was talking about mummies studied by scientists suggesting alien-human hybrids with DNA evidence which is an old topic on this forum where both sides just had to go separate ways. My only point is this thread is that there is a lot of controversial evidence out there. No, it didnt and back in that thread you were asked to present data not from a charlatan like Jaime Maussan but a respected credited DNA lab we are still waiting for it, And maussan and his crew were being investigated for things like desecration and destruction of human burial grounds and remains. 7 hours ago, janesix said: Advanced, like us. With machines and electronics, higher technology. Why would they JUST live on the coats? We don't. Have you read stuff by Charles Hoy Fort its wonderful fiction ( he claimed fact ) you might enjoy, I believe some folks do believe there were big advanced societies like us or even more technologically advanced that had their run and are gone without a shread of proof they were here, its possible but i would need proof and we have none. When i first got online most things i believed or considered went right into the garbage can, like a little kid who learns santa isnt real so i stay interested waiting for proof of things that never comes. 1 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 16, 2020 #80 Share Posted October 16, 2020 17 minutes ago, the13bats said: No, it didnt and back in that thread you were asked to present data not from a charlatan like Jaime Maussan but a respected credited DNA lab we are still waiting for it, And maussan and his crew were being investigated for things like desecration and destruction of human burial grounds and remains. Yes, that is your distorted claim on the events but that is not the truth nor the subject of this thread. 2 Link to comment Share on other sites More sharing options...
Hanslune Posted October 16, 2020 #81 Share Posted October 16, 2020 (edited) 11 minutes ago, papageorge1 said: Yes, that is your distorted claim on the events but that is not the truth nor the subject of this thread. Papageorge the dudes modified real corpses to look like 'aliens' and made money doing so. Not science just fraud best to distance yourself from such antics. Edited October 16, 2020 by Hanslune 3 Link to comment Share on other sites More sharing options...
the13bats Posted October 16, 2020 #82 Share Posted October 16, 2020 (edited) 18 minutes ago, papageorge1 said: Yes, that is your distorted claim on the events but that is not the truth nor the subject of this thread. You opened the vault to the mummy case Perception is a subject of this thread. Did you post the DNA reports from a credited source? No? Then i rest my case. Edited October 16, 2020 by the13bats Link to comment Share on other sites More sharing options...
papageorge1 Posted October 16, 2020 #83 Share Posted October 16, 2020 Just now, Hanslune said: Papageorge the dudes modified real corpses to look like 'aliens' and made money doing so. Not science just fraud best to distance yourself from such antics. That accusations are not even relevant to the cases I linked earlier in this thread for the OP. You're stuck in some loop of some controversies you liked from years again and don't care to see any new information. 1 Link to comment Share on other sites More sharing options...
the13bats Posted October 16, 2020 #84 Share Posted October 16, 2020 2 minutes ago, papageorge1 said: That accusations are not even relevant to the cases I linked earlier in this thread for the OP. You're stuck in some loop of some controversies you liked from years again and don't care to see any new information. I want new information, please post the credited DNA reports from the mummy hoax fraud case. 2 Link to comment Share on other sites More sharing options...
XenoFish Posted October 16, 2020 #85 Share Posted October 16, 2020 I think the ancients were as advanced for that time as they could be. Anything new that happened they adapted or died. 3 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 16, 2020 #86 Share Posted October 16, 2020 1 minute ago, the13bats said: You opened the vault to the mummy case Perception is a subject of this thread. Did you post the DNA reports from a credited source? No? Then i rest my case. Re-open that topic with a new thread, bats. My only involvement here was to say there is a lot of things on the table and not to conclude 'there were no advanced ancient civilizations'. 1 Link to comment Share on other sites More sharing options...
the13bats Posted October 16, 2020 #87 Share Posted October 16, 2020 2 minutes ago, papageorge1 said: Re-open that topic with a new thread, bats. My only involvement here was to say there is a lot of things on the table and not to conclude 'there were no advanced ancient civilizations'. Ill reopen the thread IF you state here that you do have accredited DNA results from a real lab nothing connected to maussan, Yes or no, do you have that new, DNA data? 1 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 16, 2020 #88 Share Posted October 16, 2020 3 minutes ago, the13bats said: Ill reopen the thread IF you state here that you do have accredited DNA results from a real lab nothing connected to maussan, Yes or no, do you have that new, DNA data? Start a new thread, it might actually be interesting. I’m due to go out and see where things stand in recent months. 1 Link to comment Share on other sites More sharing options...
the13bats Posted October 16, 2020 #89 Share Posted October 16, 2020 (edited) 26 minutes ago, papageorge1 said: Start a new thread, it might actually be interesting. I’m due to go out and see where things stand in recent months. 32 minutes ago, the13bats said: Yes or no, do you have that new, DNA data? Edited October 16, 2020 by the13bats Link to comment Share on other sites More sharing options...
kmt_sesh Posted October 16, 2020 #90 Share Posted October 16, 2020 33 minutes ago, papageorge1 said: Re-open that topic with a new thread, bats. My only involvement here was to say there is a lot of things on the table and not to conclude 'there were no advanced ancient civilizations'. I would second that, papa, although I'm not sure there's anything to add to the old thread. Do you have a link to the old thread? I? can't even remrmber what it was called. 1 Link to comment Share on other sites More sharing options...
jmccr8 Posted October 16, 2020 #91 Share Posted October 16, 2020 (edited) 11 minutes ago, kmt_sesh said: I would second that, papa, although I'm not sure there's anything to add to the old thread. Do you have a link to the old thread? I? can't even remrmber what it was called. Hi Kmt_sesh Good to see you posting again and hope all is going well for you. jmccr8 Edited October 16, 2020 by jmccr8 2 2 Link to comment Share on other sites More sharing options...
jaylemurph Posted October 16, 2020 #92 Share Posted October 16, 2020 (edited) 56 minutes ago, papageorge1 said: Re-open that topic with a new thread, bats. My only involvement here was to say there is a lot of things on the table and not to conclude 'there were no advanced ancient civilizations'. Ah, yes: this coming from someone whose intellectual position on anything is the same as a three-year-old who believes they become invisible when they cover their eyes. —Jaylemurph Edited October 16, 2020 by jaylemurph 4 3 1 Link to comment Share on other sites More sharing options...
Hanslune Posted October 16, 2020 #93 Share Posted October 16, 2020 (edited) 1 hour ago, papageorge1 said: That accusations are not even relevant to the cases I linked earlier in this thread for the OP. You're stuck in some loop of some controversies you liked from years again and don't care to see any new information. Yes they are papageorge please don't go into your 'to often used' refusal to accept reality. Yes, they are same mutilated corpses. Complete fraud. Period. Did you not watch your own link? I would suggest that you start your own thread on this and show us how we have proof of real aliens on earth. I look forward to it! I bumped that thread in Cryptozoology, Myths and Legends Edited October 16, 2020 by Hanslune 3 Link to comment Share on other sites More sharing options...
Hanslune Posted October 16, 2020 #94 Share Posted October 16, 2020 41 minutes ago, kmt_sesh said: I would second that, papa, although I'm not sure there's anything to add to the old thread. Do you have a link to the old thread? I? can't even remrmber what it was called. Glad to see you are are about. Don't you owe me 210,000 USD for keeping Harte from sending you limericks? 4 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 16, 2020 #95 Share Posted October 16, 2020 1 hour ago, Hanslune said: Yes they are papageorge please don't go into your 'to often used' refusal to accept reality. Yes, they are same mutilated corpses. Complete fraud. Period. Did you not watch your own link? I would suggest that you start your own thread on this and show us how we have proof of real aliens on earth. I look forward to it! I bumped that thread in Cryptozoology, Myths and Legends Ahh, I see. And I see your grasp of what occurred is a faulty as it's always been. By perusing my past posts I think you should be able to get you current understanding corrected. Our friend bats has been hanging upside down too long also I see. He can't keep straight what mummies we are talking about either. Perhaps you gentlemen are in need of another thrashing about by papa and the facts. 1 Link to comment Share on other sites More sharing options...
DebDandelion Posted October 16, 2020 #96 Share Posted October 16, 2020 11 hours ago, janesix said: Still, 100,000 years is a long time. My point would still be the same. Define advanced would be my thing. Are there civilizations that did things that awe us today? Yes But by which definition do we declare them advanced? Not the dictionary one, in our minds. 3 Link to comment Share on other sites More sharing options...
Hanslune Posted October 16, 2020 #97 Share Posted October 16, 2020 2 hours ago, papageorge1 said: Ahh, I see. And I see your grasp of what occurred is a faulty as it's always been. By perusing my past posts I think you should be able to get you current understanding corrected. Our friend bats has been hanging upside down too long also I see. He can't keep straight what mummies we are talking about either. Perhaps you gentlemen are in need of another thrashing about by papa and the facts. Yes please school us all - IN THAT THREAD? okay Chuckle Link to comment Share on other sites More sharing options...
the13bats Posted October 16, 2020 #98 Share Posted October 16, 2020 2 hours ago, papageorge1 said: Ahh, I see. And I see your grasp of what occurred is a faulty as it's always been. By perusing my past posts I think you should be able to get you current understanding corrected. Our friend bats has been hanging upside down too long also I see. He can't keep straight what mummies we are talking about either. Perhaps you gentlemen are in need of another thrashing about by papa and the facts. The pokes and jabs at me add zero i will ask again do you have the DNA data that backs up your claims, data from a credited source and data that has been peer reviewed by the scientific community, if you do please make that new thread and post it if you do not then no need to side step trying to toss insults just admit you dont have anything new. 4 Link to comment Share on other sites More sharing options...
Tom1200 Posted October 16, 2020 #99 Share Posted October 16, 2020 6 minutes ago, the13bats said: The pokes and jabs at me add zero i will ask again do you have the DNA data that backs up your claims, data from a credited source and data that has been peer reviewed by the scientific community, if you do please make that new thread and post it if you do not then no need to side step trying to toss insults just admit you dont have anything new. AAARRRRGGGGH! Do a bit of research. Here's your proof: Human DNA: GATCAATTGAGGTCTATGCAACGTGCCAACGAGTCACGTTGCAACGACTACCGTTGCAACCAAATGCAGT Those mummies: GGVATQCCATGCBAHACDCYGLGTDCACDCMMGVGTAGTDADJCMCGTDDPCGTGAGTIAGCACZTAT See? Extra stuff. NOT HUMAN. Got it? END OF DISCUSSION. Source - this bloke close to the Illumination but I can't name him here. But he's part of the sciency community and he's real, honest. 4 Link to comment Share on other sites More sharing options...
Hanslune Posted October 16, 2020 #100 Share Posted October 16, 2020 4 minutes ago, Tom1200 said: AAARRRRGGGGH! Do a bit of research. Here's your proof: Human DNA: GATCAATTGAGGTCTATGCAACGTGCCAACGAGTCACGTTGCAACGACTACCGTTGCAACCAAATGCAGT Those mummies: GGVATQCCATGCBAHACDCYGLGTDCACDCMMGVGTAGTDADJCMCGTDDPCGTGAGTIAGCACZTAT See? Extra stuff. NOT HUMAN. Got it? END OF DISCUSSION. Source - this bloke close to the Illumination but I can't name him here. But he's part of the sciency community and he's real, honest. Do you mean the Illuminati or the Illumination? If it's a fellow named Fernando Feghoot then I am sure it is correct . 2 Link to comment Share on other sites More sharing options...
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now