the13bats Posted October 16, 2020 #101 Share Posted October 16, 2020 12 minutes ago, Tom1200 said: AAARRRRGGGGH! Do a bit of research. Here's your proof: Human DNA: GATCAATTGAGGTCTATGCAACGTGCCAACGAGTCACGTTGCAACGACTACCGTTGCAACCAAATGCAGT Those mummies: GGVATQCCATGCBAHACDCYGLGTDCACDCMMGVGTAGTDADJCMCGTDDPCGTGAGTIAGCACZTAT See? Extra stuff. NOT HUMAN. Got it? END OF DISCUSSION. Source - this bloke close to the Illumination but I can't name him here. But he's part of the sciency community and he's real, honest. Thank you! Case proven, not desecrated human remains afterall, i did move over to the stale mummy thread so to stop derailing this thread, sorry jane 1 Link to comment Share on other sites More sharing options...
Tom1200 Posted October 16, 2020 #102 Share Posted October 16, 2020 1 hour ago, Hanslune said: Do you mean the Illuminati or the Illumination? Aren't they the same thing? Planting mind-controlling subliminal messages in our children (and - let's be honest - grown-ups) through their witty on-screen antics. Making us believe that little yellow men aren't actually real. They're evil, I tell you, EVIL. 2 Link to comment Share on other sites More sharing options...
XenoFish Posted October 16, 2020 #103 Share Posted October 16, 2020 2 hours ago, Hanslune said: Do you mean the Illuminati Don't get us involved it this.....I mean we don't exist. 3 Link to comment Share on other sites More sharing options...
janesix Posted October 16, 2020 Author #104 Share Posted October 16, 2020 18 hours ago, Abramelin said: We will thus be awaiting the light that will brighten our spirits. Sigh... I am unable to prove my point at this time. Link to comment Share on other sites More sharing options...
jethrofloyd Posted October 16, 2020 #105 Share Posted October 16, 2020 Link to comment Share on other sites More sharing options...
Thanos5150 Posted October 16, 2020 #106 Share Posted October 16, 2020 19 hours ago, Thanos5150 said: Can you please give examples with links if possible to modern "cranio-morphology" prior to 50,000BP? Let me answer it for you-there are none. And as far as Homo sapiens being "behaviorally modern" since around "100,000BP", I assume you are talking about the finds at Blombos cave which while occupation dates back to 100,000+ BP the finds in question date to c. 70,000-80,000BP. Regardless, to say humans were "behaviorally modern" dating back to this period is misleading as the level and set of cognitive abilities referred to is on par with what is observed in Neanderthals and also other than Blombos cave there is little else to show for it in-between. Link to comment Share on other sites More sharing options...
Mello_ Posted October 19, 2020 #107 Share Posted October 19, 2020 On 10/15/2020 at 6:09 PM, janesix said: For a very long time I was sure there had to have been an advanced ancient civilization, probably many that had risen and fallen over the milleniums and precessional ages. Really, "modern" humans have been around for at least 200,000 years, with our brain capacities and behaviors. So why would we have only invented civilization in the last 6000 years? I have read much of Graham Hancock and the like, and was convinced there had to have been advanced civilizations before us. But over the last year or so, I've come to realize this probably isn't true. There is simply no evidence for it. We find the remains of hunter/gatherers back through time, but zero evidence of an advanced culture. Sadly, the time has come for me to give up on this idea. And figure out WHY we have only just recently been able to advance. Ta da!!! Ofc. But... I quite positive that we better societies than today. So from sociology stance: yes, there were more advanced civilizations than today. Imho as we go in this technocracy and all this madness...as we mature and gain tech we are morally going down. Link to comment Share on other sites More sharing options...
jethrofloyd Posted October 19, 2020 #108 Share Posted October 19, 2020 1 hour ago, Mello_ said: So from sociology stance: yes, there were more advanced civilizations than today. What are these civilizations? Roman Empire? Greece? Link to comment Share on other sites More sharing options...
Mello_ Posted October 21, 2020 #109 Share Posted October 21, 2020 On 10/19/2020 at 10:03 PM, jethrofloyd said: What are these civilizations? Roman Empire? Greece? Nah. I would rather choose different examples. Lets say Barcelona during Spanish civil war. Even was war economy was booming. And that is still subject of economic research. During war, with abolished money they lived better than half of today Europe. I suspect America. Now two people works. Mother and father. Often more than one job. They have one kid. And its strugle. My granma didnt work. Only granpa. And they have 4 children. And all 4 of them say they have more than enough. But it isnt all about economics. I personally believe that we are morally going down. Tech up-morale down. Its obvious. Link to comment Share on other sites More sharing options...
Harte Posted October 24, 2020 #110 Share Posted October 24, 2020 On 10/15/2020 at 11:42 AM, papageorge1 said: There aren't many mummies to go on. And mysterious ones like some I've head of from South America suggesting advanced non-human humanoid-alien like species get tangled in controversy. Papa's new hobby: Harte 1 Link to comment Share on other sites More sharing options...
jaylemurph Posted October 24, 2020 #111 Share Posted October 24, 2020 It’s rude to take advantage of papa’s naïveté, Harte. Except financially. He’s going to be p***ed when he discovers I’m ghost writing his marvel-gawpers and his $24.95 a volume is getting recycled into Dalek figurines. —Jaylemurph 3 Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #112 Share Posted October 24, 2020 On 10/15/2020 at 5:24 PM, papageorge1 said: I believe there were advanced ancient civilizations. what would you class as advanced in this context? Link to comment Share on other sites More sharing options...
papageorge1 Posted October 24, 2020 #113 Share Posted October 24, 2020 31 minutes ago, Dejarma said: what would you class as advanced in this context? Includes technologies beyond our current knowledge and some of those ‘alien inspired’. Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #114 Share Posted October 24, 2020 3 minutes ago, papageorge1 said: Includes technologies beyond our current knowledge and some of those ‘alien inspired’. a serious question: why would you believe this without evidence? 1 1 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 24, 2020 #115 Share Posted October 24, 2020 54 minutes ago, Harte said: Papa's new hobby: Harte I’ve been nominated as I said earlier for the Grave Robbers/Indigenous Desecrators ‘Dirty Shovel‘ annual Award. Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #116 Share Posted October 24, 2020 1 minute ago, papageorge1 said: I’ve been nominated as I said earlier for the Grave Robbers/Indigenous Desecrators ‘Dirty Shovel‘ annual Award. what? Link to comment Share on other sites More sharing options...
papageorge1 Posted October 24, 2020 #117 Share Posted October 24, 2020 2 minutes ago, Dejarma said: a serious question: why would you believe this without evidence? Because I believe there is evidence including from multiple psychic sources I respect. Link to comment Share on other sites More sharing options...
Sir Wearer of Hats Posted October 24, 2020 #118 Share Posted October 24, 2020 6 minutes ago, Dejarma said: a serious question: why would you believe this without evidence? Because he’s an idiot. 2 2 1 Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #119 Share Posted October 24, 2020 1 minute ago, papageorge1 said: Because I believe there is evidence including from multiple psychic sources I respect. well that's all you need i guess talking logically though: if us humans were to become extinct in x amount of years time there would be remanence of our existence/ tech .. Do you agree? 1 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 24, 2020 #120 Share Posted October 24, 2020 Just now, Dejarma said: well that's all you need i guess talking logically though: if us humans were to become extinct in x amount of years time there would be remanence of our existence/ tech .. Do you agree? Not if it’s under the ocean or if we don’t even understood all about the artifacts out there. Lot of it is still mysterious. How much we still don’t know about ancient history astounds me. Who knows what is still buried? Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #121 Share Posted October 24, 2020 1 minute ago, papageorge1 said: Not if it’s under the ocean or if we don’t even understood all about the artifacts out there. Lot of it is still mysterious. How much we still don’t know about ancient history astounds me. Who knows what is still buried? yeah good point but absolutely NOTHING AT ALL regarding evidence of this ancient higher-tech!!?: no rotting CPU equivalent for example??? 2 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 24, 2020 #122 Share Posted October 24, 2020 (edited) 10 minutes ago, Dejarma said: yeah good point but absolutely NOTHING AT ALL regarding evidence of this ancient higher-tech!!?: no rotting CPU equivalent for example??? Would we know a rotting equivalent of something we don’t understand? Or would they get tied up in fringe books and Ancient Alien shows? or? I throw out things like buried giant crystal technology even underground in Mt. Magna Arkansas (per Kryon). Edited October 24, 2020 by papageorge1 Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #123 Share Posted October 24, 2020 1 minute ago, papageorge1 said: Would we know a rotting equivalent of something we don’t understand? apparently, we do according to you= what are you talking about.. Are you insulting my intelligence? 1 1 Link to comment Share on other sites More sharing options...
papageorge1 Posted October 24, 2020 #124 Share Posted October 24, 2020 Just now, Dejarma said: apparently, we do according to you= what are you talking about.. Are you insulting my intelligence? Don’t get your post? We have artifacts speculated on. Link to comment Share on other sites More sharing options...
Dejarma Posted October 24, 2020 #125 Share Posted October 24, 2020 Just now, papageorge1 said: Don’t get your post? We have artifacts speculated on. yeah pap i luv ya but you do my head in mate= enjoy your fantasy Link to comment Share on other sites More sharing options...
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now